descseq Wiki The master copies of EMBOSS documentation are available at http://emboss.open-bio.org/wiki/Appdocs on the EMBOSS Wiki. Please help by correcting and extending the Wiki pages. Function Alter the name or description of a sequence Description descseq reads a sequence and writes it to file but with a different name and / or description. All other records including the sequence itself are left unaltered. Usage Here is a sample session with descseq Set the name of a sequence to "myclone23" % descseq -seq dna.text -out clone23.seq -name "myclone23" Alter the name or description of a sequence. Go to the input files for this example Go to the output files for this example Example 2 Set the description of a sequence to "This is my clone number 244" % descseq -seq dna.text -out xy24.seq -desc "This is my clone number 244" Alter the name or description of a sequence. Go to the output files for this example Example 3 Append some text to the description of a sequence % descseq -seq dna.text -out est4.seq -desc " (submitted)" -append Alter the name or description of a sequence. Go to the output files for this example Command line arguments Alter the name or description of a sequence. Version: EMBOSS:6.5.6.0 Standard (Mandatory) qualifiers: [-sequence] sequence (Gapped) sequence filename and optional format, or reference (input USA) [-outseq] seqout [.] Sequence filename and optional format (output USA) Additional (Optional) qualifiers: -name string Name of the sequence (Any string) -description string Description of the sequence (Any string) Advanced (Unprompted) qualifiers: -append boolean [N] This allows you to append the name or description you have given on to the end of the existing name or description of the sequence. Associated qualifiers: "-sequence" associated qualifiers -sbegin1 integer Start of the sequence to be used -send1 integer End of the sequence to be used -sreverse1 boolean Reverse (if DNA) -sask1 boolean Ask for begin/end/reverse -snucleotide1 boolean Sequence is nucleotide -sprotein1 boolean Sequence is protein -slower1 boolean Make lower case -supper1 boolean Make upper case -scircular1 boolean Sequence is circular -sformat1 string Input sequence format -iquery1 string Input query fields or ID list -ioffset1 integer Input start position offset -sdbname1 string Database name -sid1 string Entryname -ufo1 string UFO features -fformat1 string Features format -fopenfile1 string Features file name "-outseq" associated qualifiers -osformat2 string Output seq format -osextension2 string File name extension -osname2 string Base file name -osdirectory2 string Output directory -osdbname2 string Database name to add -ossingle2 boolean Separate file for each entry -oufo2 string UFO features -offormat2 string Features format -ofname2 string Features file name -ofdirectory2 string Output directory General qualifiers: -auto boolean Turn off prompts -stdout boolean Write first file to standard output -filter boolean Read first file from standard input, write first file to standard output -options boolean Prompt for standard and additional values -debug boolean Write debug output to program.dbg -verbose boolean Report some/full command line options -help boolean Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose -warning boolean Report warnings -error boolean Report errors -fatal boolean Report fatal errors -die boolean Report dying program messages -version boolean Report version number and exit Input file format descseq reads a single nucleotide or protein sequence. The input is a standard EMBOSS sequence query (also known as a 'USA'). Major sequence database sources defined as standard in EMBOSS installations include srs:embl, srs:uniprot and ensembl Data can also be read from sequence output in any supported format written by an EMBOSS or third-party application. The input format can be specified by using the command-line qualifier -sformat xxx, where 'xxx' is replaced by the name of the required format. The available format names are: gff (gff3), gff2, embl (em), genbank (gb, refseq), ddbj, refseqp, pir (nbrf), swissprot (swiss, sw), dasgff and debug. See: http://emboss.sf.net/docs/themes/SequenceFormats.html for further information on sequence formats. Input files for usage example File: dna.text ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTAC GTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT Output file format descseq writes the sequence file with a changed name or description. The output is a standard EMBOSS sequence file. The results can be output in one of several styles by using the command-line qualifier -osformat xxx, where 'xxx' is replaced by the name of the required format. The available format names are: embl, genbank, gff, pir, swiss, dasgff, debug, listfile, dbmotif, diffseq, excel, feattable, motif, nametable, regions, seqtable, simple, srs, table, tagseq. See: http://emboss.sf.net/docs/themes/SequenceFormats.html for further information on sequence formats. Output files for usage example File: clone23.seq >myclone23 ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT Output files for usage example 2 File: xy24.seq >EMBOSS_001 This is my clone number 244 ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT Output files for usage example 3 File: est4.seq >EMBOSS_001 (submitted) ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT Data files None. Notes Most sequence formats allow, at the very minimum, a name for the sequence and some comments to be stored in the sequence file. descseq let's you change the sequence name and / or description, and is far more convenient and less error-prone than using the editor for editing. The default action is to replace the existing name or description with your new one, but by using the qualifier -append what you enter is appended to the existing name or description. Note that if you append to a description, no space is inserted by default bewteen the existing description and your appended text. You have to put in a space yourself if you require one. References None. Warnings None. Diagnostic Error Messages None. Exit status It always exits with status 0. Known bugs None noted. See also Program name Description aligncopy Read and write alignments aligncopypair Read and write pairs from alignments biosed Replace or delete sequence sections codcopy Copy and reformat a codon usage table cutseq Remove a section from a sequence degapseq Remove non-alphabetic (e.g. gap) characters from sequences entret Retrieve sequence entries from flatfile databases and files extractalign Extract regions from a sequence alignment extractfeat Extract features from sequence(s) extractseq Extract regions from a sequence featcopy Read and write a feature table featmerge Merge two overlapping feature tables featreport Read and write a feature table feattext Return a feature table original text listor Write a list file of the logical OR of two sets of sequences makenucseq Create random nucleotide sequences makeprotseq Create random protein sequences maskambignuc Mask all ambiguity characters in nucleotide sequences with N maskambigprot Mask all ambiguity characters in protein sequences with X maskfeat Write a sequence with masked features maskseq Write a sequence with masked regions newseq Create a sequence file from a typed-in sequence nohtml Remove mark-up (e.g. HTML tags) from an ASCII text file noreturn Remove carriage return from ASCII files nospace Remove whitespace from an ASCII text file notab Replace tabs with spaces in an ASCII text file notseq Write to file a subset of an input stream of sequences nthseq Write to file a single sequence from an input stream of sequences nthseqset Read and write (return) one set of sequences from many pasteseq Insert one sequence into another revseq Reverse and complement a nucleotide sequence seqcount Read and count sequences seqret Read and write (return) sequences seqretsetall Read and write (return) many sets of sequences seqretsplit Read sequences and write them to individual files sizeseq Sort sequences by size skipredundant Remove redundant sequences from an input set skipseq Read and write (return) sequences, skipping first few splitsource Split sequence(s) into original source sequences splitter Split sequence(s) into smaller sequences trimest Remove poly-A tails from nucleotide sequences trimseq Remove unwanted characters from start and end of sequence(s) trimspace Remove extra whitespace from an ASCII text file union Concatenate multiple sequences into a single sequence vectorstrip Remove vectors from the ends of nucleotide sequence(s) yank Add a sequence reference (a full USA) to a list file Author(s) Gary Williams formerly at: MRC Rosalind Franklin Centre for Genomics Research Wellcome Trust Genome Campus, Hinxton, Cambridge, CB10 1SB, UK Please report all bugs to the EMBOSS bug team (emboss-bug (c) emboss.open-bio.org) not to the original author. History Target users This program is intended to be used by everyone and everything, from naive users to embedded scripts. Comments None