extractalign Wiki The master copies of EMBOSS documentation are available at http://emboss.open-bio.org/wiki/Appdocs on the EMBOSS Wiki. Please help by correcting and extending the Wiki pages. Function Extract regions from a sequence alignment Description extractalign allows you to specify one or more regions of a sequence alignment to extract sub-sequences from to build up a resulting sub-sequence alignment. extractalign reads in a sequence alignment and a set of regions of that alignment as specified by pairs of start and end positions (either on the command-line or contained in a file) using gapped alignment positions as the coordinates, and writes out the specified regions of the input sequence in the order in which they have been specified. Thus, if the sequence "AAAGGGTTT" has been input and the regions: "7-9, 3-4" have been specified, then the output sequence will be: "TTTAG". Usage Here is a sample session with extractalign Extract the region from position 10 to 20: % extractalign dna.msf result.seq -regions "11-30" Extract regions from a sequence alignment Go to the input files for this example Go to the output files for this example Command line arguments Extract regions from a sequence alignment Version: EMBOSS:6.5.6.0 Standard (Mandatory) qualifiers: [-sequence] seqset (Aligned) sequence set filename and optional format, or reference (input USA) -regions range [Whole sequence] Regions to extract. A set of regions is specified by a set of pairs of positions. The positions are integers. They are separated by any non-digit, non-alpha character. Examples of region specifications are: 24-45, 56-78 1:45, 67=99;765..888 1,5,8,10,23,45,57,99 [-outseq] seqoutall [.] Sequence set(s) filename and optional format (output USA) Additional (Optional) qualifiers: (none) Advanced (Unprompted) qualifiers: (none) Associated qualifiers: "-sequence" associated qualifiers -sbegin1 integer Start of each sequence to be used -send1 integer End of each sequence to be used -sreverse1 boolean Reverse (if DNA) -sask1 boolean Ask for begin/end/reverse -snucleotide1 boolean Sequence is nucleotide -sprotein1 boolean Sequence is protein -slower1 boolean Make lower case -supper1 boolean Make upper case -scircular1 boolean Sequence is circular -sformat1 string Input sequence format -iquery1 string Input query fields or ID list -ioffset1 integer Input start position offset -sdbname1 string Database name -sid1 string Entryname -ufo1 string UFO features -fformat1 string Features format -fopenfile1 string Features file name "-outseq" associated qualifiers -osformat2 string Output seq format -osextension2 string File name extension -osname2 string Base file name -osdirectory2 string Output directory -osdbname2 string Database name to add -ossingle2 boolean Separate file for each entry -oufo2 string UFO features -offormat2 string Features format -ofname2 string Features file name -ofdirectory2 string Output directory General qualifiers: -auto boolean Turn off prompts -stdout boolean Write first file to standard output -filter boolean Read first file from standard input, write first file to standard output -options boolean Prompt for standard and additional values -debug boolean Write debug output to program.dbg -verbose boolean Report some/full command line options -help boolean Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose -warning boolean Report warnings -error boolean Report errors -fatal boolean Report fatal errors -die boolean Report dying program messages -version boolean Report version number and exit Input file format extractalign reads aligned nucleotide or protein sequences. The input is a standard EMBOSS sequence query (also known as a 'USA'). Major sequence database sources defined as standard in EMBOSS installations include srs:embl, srs:uniprot and ensembl Data can also be read from sequence output in any supported format written by an EMBOSS or third-party application. The input format can be specified by using the command-line qualifier -sformat xxx, where 'xxx' is replaced by the name of the required format. The available format names are: gff (gff3), gff2, embl (em), genbank (gb, refseq), ddbj, refseqp, pir (nbrf), swissprot (swiss, sw), dasgff and debug. See: http://emboss.sf.net/docs/themes/SequenceFormats.html for further information on sequence formats. Input files for usage example File: dna.msf !!NA_MULTIPLE_ALIGNMENT dna.msf MSF: 120 Type: N January 01, 1776 12:00 Check: 3196 .. Name: MSFM1 Len: 120 Check: 8587 Weight: 1.00 Name: MSFM2 Len: 120 Check: 6178 Weight: 1.00 Name: MSFM3 Len: 120 Check: 8431 Weight: 1.00 // MSFM1 ACGTACGTAC GTACGTACGT ACGTACGTAC GTACGTACGT ACGTACGTAC MSFM2 ACGTACGTAC GTACGTACGT ....ACGTAC GTACGTACGT ACGTACGTAC MSFM3 ACGTACGTAC GTACGTACGT ACGTACGTAC GTACGTACGT CGTACGTACG MSFM1 GTACGTACGT ACGTACGTAC GTACGTACGT ACGTACGTAC GTACGTACGT MSFM2 GTACGTACGT ACGTACGTAC GTACGTACGT ACGTACGTAC GTACGTACGT MSFM3 TACGTACGTA CGTACGTACG TACGTACGTA ACGTACGTAC GTACGTACGT MSFM1 ACGTACGTAC GTACGTACGT MSFM2 ACGTACGTTG CAACGTACGT MSFM3 ACGTACGTAC GTACGTACGT You can specify a file of ranges to extract by giving the '-regions' qualifier the value '@' followed by the name of the file containing the ranges. (eg: '-regions @myfile'). The format of the range file is: * Comment lines start with '#' in the first column. * Comment lines and blank lines are ignored. * The line may start with white-space. * There are two positive (integer) numbers per line separated by one or more space or TAB characters. * The second number must be greater or equal to the first number. * There can be optional text after the two numbers to annotate the line. * White-space before or after the text is removed. An example range file is: # this is my set of ranges 12 23 4 5 this is like 12-23, but smaller 67 10348 interesting region Output file format The output is a normal sequence file. Output files for usage example File: result.seq >MSFM1 GTACGTACGTACGTACGTAC >MSFM2 GTACGTACGT----ACGTAC >MSFM3 GTACGTACGTACGTACGTAC If the option '-separate' is used then each specified region is written to the output file as a separate sequence. The name of the sequence is created from the name of the original sequence with the start and end positions of the range appended with underscore characters between them, For example: "XYZ region 2 to 34" is written as: "XYZ_2_34" Data files None. Notes None. References None. Warnings None. Diagnostic Error Messages Several warning messages about malformed region specifications: * Non-digit found in region ... * Unpaired start of a region found in ... * Non-digit found in region ... * The start of a pair of region positions must be smaller than the end in ... Exit status It exits with status 0, unless a region is badly constructed. Known bugs None noted. Comments See also Program name Description abiview Display the trace in an ABI sequencer file aligncopy Read and write alignments aligncopypair Read and write pairs from alignments biosed Replace or delete sequence sections codcopy Copy and reformat a codon usage table coderet Extract CDS, mRNA and translations from feature tables cutseq Remove a section from a sequence degapseq Remove non-alphabetic (e.g. gap) characters from sequences descseq Alter the name or description of a sequence entret Retrieve sequence entries from flatfile databases and files extractfeat Extract features from sequence(s) extractseq Extract regions from a sequence featcopy Read and write a feature table featmerge Merge two overlapping feature tables featreport Read and write a feature table feattext Return a feature table original text infoalign Display basic information about a multiple sequence alignment infoseq Display basic information about sequences listor Write a list file of the logical OR of two sets of sequences makenucseq Create random nucleotide sequences makeprotseq Create random protein sequences maskambignuc Mask all ambiguity characters in nucleotide sequences with N maskambigprot Mask all ambiguity characters in protein sequences with X maskfeat Write a sequence with masked features maskseq Write a sequence with masked regions newseq Create a sequence file from a typed-in sequence nohtml Remove mark-up (e.g. HTML tags) from an ASCII text file noreturn Remove carriage return from ASCII files nospace Remove whitespace from an ASCII text file notab Replace tabs with spaces in an ASCII text file notseq Write to file a subset of an input stream of sequences nthseq Write to file a single sequence from an input stream of sequences nthseqset Read and write (return) one set of sequences from many pasteseq Insert one sequence into another refseqget Get reference sequence revseq Reverse and complement a nucleotide sequence seqcount Read and count sequences seqret Read and write (return) sequences seqretsetall Read and write (return) many sets of sequences seqretsplit Read sequences and write them to individual files seqxref Retrieve all database cross-references for a sequence entry seqxrefget Retrieve all cross-referenced data for a sequence entry showalign Display a multiple sequence alignment in pretty format sizeseq Sort sequences by size skipredundant Remove redundant sequences from an input set skipseq Read and write (return) sequences, skipping first few splitsource Split sequence(s) into original source sequences splitter Split sequence(s) into smaller sequences trimest Remove poly-A tails from nucleotide sequences trimseq Remove unwanted characters from start and end of sequence(s) trimspace Remove extra whitespace from an ASCII text file union Concatenate multiple sequences into a single sequence variationget Get sequence variations vectorstrip Remove vectors from the ends of nucleotide sequence(s) whichdb Search all sequence databases for an entry and retrieve it yank Add a sequence reference (a full USA) to a list file Author(s) Peter Rice European Bioinformatics Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge CB10 1SD, UK Please report all bugs to the EMBOSS bug team (emboss-bug (c) emboss.open-bio.org) not to the original author. History Target users This program is intended to be used by everyone and everything, from naive users to embedded scripts. Comments None