seqretsplit
Wiki
The master copies of EMBOSS documentation are available at
http://emboss.open-bio.org/wiki/Appdocs on the EMBOSS Wiki.
Please help by correcting and extending the Wiki pages.
Function
Read sequences and write them to individual files
Description
seqretsplit is a variant of the standard program for reading and
writing sequences, seqret. It performs exactly the same function except
that when it reads more than one sequence, it writes each sequence to
an individual file. In all other respects, skipseq is the same as
seqret. Its main use is therefore to split a file containing multiple
sequences into many files, each containing one sequence. There are many
options built-in into EMBOSS for detailed specification of the input
and output sequences, for example the sequence type and file format.
Optionally, feature information will be read and written.
Usage
Here is a sample session with seqretsplit
% seqretsplit tembl:m1190*
Read sequences and write them to individual files
output sequence(s) [m11903.fasta]:
Go to the input files for this example
Go to the output files for this example
The specification of the output file is not used in this case.
At some point this ought to change and you will not be prompted for the
output file at all.
Command line arguments
Read sequences and write them to individual files
Version: EMBOSS:6.5.6.0
Standard (Mandatory) qualifiers:
[-sequence] seqall (Gapped) sequence(s) filename and optional
format, or reference (input USA)
[-outseq] seqoutall [.] Sequence set(s)
filename and optional format (output USA)
Additional (Optional) qualifiers: (none)
Advanced (Unprompted) qualifiers:
-feature boolean Use feature information
-firstonly boolean Read one sequence and stop
Associated qualifiers:
"-sequence" associated qualifiers
-sbegin1 integer Start of each sequence to be used
-send1 integer End of each sequence to be used
-sreverse1 boolean Reverse (if DNA)
-sask1 boolean Ask for begin/end/reverse
-snucleotide1 boolean Sequence is nucleotide
-sprotein1 boolean Sequence is protein
-slower1 boolean Make lower case
-supper1 boolean Make upper case
-scircular1 boolean Sequence is circular
-sformat1 string Input sequence format
-iquery1 string Input query fields or ID list
-ioffset1 integer Input start position offset
-sdbname1 string Database name
-sid1 string Entryname
-ufo1 string UFO features
-fformat1 string Features format
-fopenfile1 string Features file name
"-outseq" associated qualifiers
-osformat2 string Output seq format
-osextension2 string File name extension
-osname2 string Base file name
-osdirectory2 string Output directory
-osdbname2 string Database name to add
-ossingle2 boolean Separate file for each entry
-oufo2 string UFO features
-offormat2 string Features format
-ofname2 string Features file name
-ofdirectory2 string Output directory
General qualifiers:
-auto boolean Turn off prompts
-stdout boolean Write first file to standard output
-filter boolean Read first file from standard input, write
first file to standard output
-options boolean Prompt for standard and additional values
-debug boolean Write debug output to program.dbg
-verbose boolean Report some/full command line options
-help boolean Report command line options and exit. More
information on associated and general
qualifiers can be found with -help -verbose
-warning boolean Report warnings
-error boolean Report errors
-fatal boolean Report fatal errors
-die boolean Report dying program messages
-version boolean Report version number and exit
Input file format
seqretsplit reads one or more nucleotide or protein sequences.
The input is a standard EMBOSS sequence query (also known as a 'USA').
Major sequence database sources defined as standard in EMBOSS
installations include srs:embl, srs:uniprot and ensembl
Data can also be read from sequence output in any supported format
written by an EMBOSS or third-party application.
The input format can be specified by using the command-line qualifier
-sformat xxx, where 'xxx' is replaced by the name of the required
format. The available format names are: gff (gff3), gff2, embl (em),
genbank (gb, refseq), ddbj, refseqp, pir (nbrf), swissprot (swiss, sw),
dasgff and debug.
See: http://emboss.sf.net/docs/themes/SequenceFormats.html for further
information on sequence formats.
Input files for usage example
'tembl:m1190*' is a sequence entry in the example nucleic acid database
'tembl'
Output file format
The output is a standard EMBOSS sequence file.
The results can be output in one of several styles by using the
command-line qualifier -osformat xxx, where 'xxx' is replaced by the
name of the required format. The available format names are: embl,
genbank, gff, pir, swiss, dasgff, debug, listfile, dbmotif, diffseq,
excel, feattable, motif, nametable, regions, seqtable, simple, srs,
table, tagseq.
See: http://emboss.sf.net/docs/themes/SequenceFormats.html for further
information on sequence formats.
Output files for usage example
File: m11903.fasta
>M11903 M11903.1 Rattus norvegicus androgen-responsive protein precursor (Svf) g
ene, exons 1 and 1A, alternatively spliced.
cctttcaaatagaaactctcgtgaaggctgtctgagaacacaagctcaaggttgtgactg
atttcagtgatgccgtcttgaagagggataccgtgctagagaatgactcctgatcaaccc
tgaagacttctgcaagcccgaagtcgtgcttccccactctgaactgacatatgttcagga
agtagagacgtgcaccgttggatgttctcaaggtaaaaaggaagatttggaagaatgctc
tagtgttgttgccttggagaggaccagggaacagtacaagactcctactgagcagagaga
aaggagcctgacatttaccgataagaaaggtcatttgccttccaacctgtaggcaaggcc
agacaaggaaatatataaaggagaacctcagatcagctctcagtcaagacccttcctgac
aagatgagtcccaccgggttcttcctccttacggtgctccttgttctggtgacagaagca
gcctcgagggggccccgaggtgagtggcaattttgtgctatgggaaagatgtttgagaac
tatgttctcaaaagggagtctgcagaatgctgtgttcccagggcttctccatgaaggaaa
cttgagtcttttcaagctttaaccatagtcctactgtgagtctctgtgacttgacaagca
acattgctggtaaggagggctgagggggaatgcgggcaacggcctcgggtaacatcctca
ttgt
File: m11904.fasta
>M11904 M11904.1 Rattus norvegicus androgen-responsive protein precursor (Svf) g
ene, exon 2 and complete cds.
ggtatctccaaacacagcagctggctctcaacagagagtcctcatgcacaactaatccaa
gatacagaaagtggatatagagaatgagacattgttttctctcaacagaaaaattctcac
agtcagctgaagacccttatagtgaaaacatgaatctaaagattctggcgagcgggaggg
gatcaagttctacctttggggcattcagccgaagtgagaactctcggagtaacttcaaat
caaaaagtccaagcagtatcaccagggagaaagtgaatgaggaaagcaggagtgaaatga
gtagtaccagcagccattttggtctcaaaatgagaagatctcatggaggaggagaaatga
atccctttgaaaccaaagtaaagacccggatcactcgcaaataatgtgttccccggccaa
ctgaagacttgagcccaataggcaggtaagtgttatcaccaggtgagggcttacaaacta
ctcgtgcctaatccctaggccattgtaggattgtgcacgcagtaaagttgctataagggg
aggtatggaaacgacctacaaggcagacaaagatacgagctatactgtgt
File: m11905.fasta
>M11905 M11905.1 Rattus norvegicus androgen-responsive protein precursor (Svf) g
ene, exon 3.
ccgtgcaatctcttcctgtgtccacacagccctgttagaagcaactctctcgttctcaag
gccctacctgcaagaactacctttctcttcctccgcccaacaaaggaggaatgtttctgc
ttgtgacccaccagagatgaaatatagcagtgtcctgcagtaaaggggggccccagaggc
atgggacatacacgcattaatccctccacgtcttccctgtcctacctcacaggttgtcct
cgttccctgggtgtcactgaactaagagaagtctatgatgtcttcaggatgcaggatccc
acaggtgccccggaaatagtccgtgcttcttatttcctccttacacttgttttctttaag
attccggaacctgacaagattcaaatttaaccttttcaataaaaaagatactattctgca
tcattatctcctgaaatctcttgcttctgcagtacaggggctgggtgggattcctaaact
tgaccagttctgccgttaaaggaagatcccttctgtgccgtatcagagactatttccaga
ctctggataga
One file for each input sequence is written out.
The names of the files it creates are derived from the ID name of the
sequence, followed by an extension denoting the format of the sequence.
You have no control over the names of the files it writes out.
For example, if the files embl:hsfa11* are read in and the output is
specified as wibble.seq, then the following files are expected to be
created:
hsfa110.fasta
hsfa111.fasta
hsfa112.fasta
hsfa113.fasta
hsfa114.fasta
(No file wibble.seq is created.)
Data files
None.
Notes
See the documentation for seqret to see the full range of things that
you can do when reading and writing sequences.
Some non-EMBOSS programs will accept only single sequences. In such
cases seqretsplit is useful for splitting a multiple sequence file into
many individual files. Some EMBOSS programs will also read only a
single sequence, which may, however, be one of many in a file. You can
specify the sequence using the USA filename:sequenceID. Nonetheless,
some people feel more comfortable handling one sequence per file, so
seqretsplit will be useful to them too.
One file for each input sequence is written. The names of the files it
creates are derived from the ID name of the sequence, followed by an
extension denoting the format of the sequence. You have no control over
the names of the files it writes out. For example, if the files
embl:hsfa11* are read in and the output is specified as wibble.seq,
then the following files are expected to be created:
hsfa110.fasta
hsfa111.fasta
hsfa112.fasta
hsfa113.fasta
hsfa114.fasta
(No file wibble.seq is created.)
References
None.
Warnings
None.
Diagnostic Error Messages
None.
Exit status
It always exits with status 0.
Known bugs
It shouldn't really prompt for the output filename.
This is a side effect of the way sequence output works in EMBOSS.
Writing multiple sequences to separate files (the -ossingle qualifier)
does this, and seqretsplit has set it automatically on.
See also
Program name Description
aligncopy Read and write alignments
aligncopypair Read and write pairs from alignments
biosed Replace or delete sequence sections
codcopy Copy and reformat a codon usage table
cutseq Remove a section from a sequence
degapseq Remove non-alphabetic (e.g. gap) characters from sequences
descseq Alter the name or description of a sequence
entret Retrieve sequence entries from flatfile databases and files
extractalign Extract regions from a sequence alignment
extractfeat Extract features from sequence(s)
extractseq Extract regions from a sequence
featcopy Read and write a feature table
featmerge Merge two overlapping feature tables
featreport Read and write a feature table
feattext Return a feature table original text
listor Write a list file of the logical OR of two sets of sequences
makenucseq Create random nucleotide sequences
makeprotseq Create random protein sequences
maskambignuc Mask all ambiguity characters in nucleotide sequences with
N
maskambigprot Mask all ambiguity characters in protein sequences with X
maskfeat Write a sequence with masked features
maskseq Write a sequence with masked regions
newseq Create a sequence file from a typed-in sequence
nohtml Remove mark-up (e.g. HTML tags) from an ASCII text file
noreturn Remove carriage return from ASCII files
nospace Remove whitespace from an ASCII text file
notab Replace tabs with spaces in an ASCII text file
notseq Write to file a subset of an input stream of sequences
nthseq Write to file a single sequence from an input stream of
sequences
nthseqset Read and write (return) one set of sequences from many
pasteseq Insert one sequence into another
revseq Reverse and complement a nucleotide sequence
seqcount Read and count sequences
seqret Read and write (return) sequences
seqretsetall Read and write (return) many sets of sequences
sizeseq Sort sequences by size
skipredundant Remove redundant sequences from an input set
skipseq Read and write (return) sequences, skipping first few
splitsource Split sequence(s) into original source sequences
splitter Split sequence(s) into smaller sequences
trimest Remove poly-A tails from nucleotide sequences
trimseq Remove unwanted characters from start and end of sequence(s)
trimspace Remove extra whitespace from an ASCII text file
union Concatenate multiple sequences into a single sequence
vectorstrip Remove vectors from the ends of nucleotide sequence(s)
yank Add a sequence reference (a full USA) to a list file
Author(s)
Peter Rice
European Bioinformatics Institute, Wellcome Trust Genome Campus,
Hinxton, Cambridge CB10 1SD, UK
Please report all bugs to the EMBOSS bug team
(emboss-bug (c) emboss.open-bio.org) not to the original author.
History
Written (Jan 2000) - Peter Rice
Target users
This program is intended to be used by everyone and everything, from
naive users to embedded scripts.
Comments
The specification of the output file is not used when the output file
names are generated automatically..
At some point this ought to change and you will not be prompted for the
output file at all.