CollectAlignmentSummaryMetrics (Picard)

Produces a summary of alignment metrics from a SAM or BAM file. This tool takes a SAM/BAM file input and produces metrics detailing the quality of the read alignments as well as the proportion of the reads that passed machine signal-to-noise threshold quality filters. Note that these quality filters are specific to Illumina data; for additional information, please see the corresponding GATK Dictionary entry.

Note: Metrics labeled as percentages are actually expressed as fractions!

Usage example:

    java -jar picard.jar CollectAlignmentSummaryMetrics \
          R=reference_sequence.fasta \
          I=input.bam \
          O=output.txt

Please see the CollectAlignmentSummaryMetrics definitions for a complete description of the metrics produced by this tool.

---

Category Diagnostics and Quality Control

---

Overview

A command line tool to read a BAM file and produce standard alignment metrics that would be applicable to any alignment. Metrics to include, but not limited to:

• Total number of reads (total, period, no exclusions)
• Total number of PF reads (PF == does not fail vendor check flag)
• Number of PF noise reads (does not fail vendor check and has noise attr set)
• Total aligned PF reads (any PF read that has a sequence and position)
• High quality aligned PF reads (high quality == mapping quality >= 20)
• High quality aligned PF bases (actual aligned bases, calculate off alignment blocks)
• High quality aligned PF Q20 bases (subset of above where base quality >= 20)
• Median mismatches in HQ aligned PF reads (how many aligned bases != ref on average)
• Reads aligned in pairs (vs. reads aligned with mate unaligned/not present)
• Read length (how to handle mixed lengths?)
• Bad Cycles - how many machine cycles yielded combined no-call and mismatch rates of >= 80%
• Strand balance - reads mapped to positive strand / total mapped reads

Metrics are written for the first read of a pair, the second read, and combined for the pair. Chimeras are identified if any of the of following criteria are met:

• the insert size is larger than MAX_INSERT_SIZE
• the ends of a pair map to different contigs
• the paired end orientation is different that the expected orientation
• the read contains an SA tag (chimeric alignment)

CollectAlignmentSummaryMetrics (Picard) specific arguments

This table summarizes the command-line arguments that are specific to this tool. For more details on each argument, see the list further down below the table or click on an argument name to jump directly to that entry in the list.

Argument name(s)	Default value	Summary
Required Arguments
--INPUT  -I	null	Input SAM or BAM file.
--OUTPUT  -O	null	File to write the output to.
Optional Tool Arguments
--ADAPTER_SEQUENCE	[AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, AGATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG, AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGTCTTCTGCTTG, AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG]	List of adapter sequences to use when processing the alignment metrics.
--arguments_file	[]	read one or more arguments files and add them to the command line
--ASSUME_SORTED  -AS	true	If true (default), then the sort order in the header file will be ignored.
--EXPECTED_PAIR_ORIENTATIONS	[FR]	Paired-end reads that do not have this expected orientation will be considered chimeric.
--help  -h	false	display the help message
--IS_BISULFITE_SEQUENCED  -BS	false	Whether the SAM or BAM file consists of bisulfite sequenced reads.
--MAX_INSERT_SIZE	100000	Paired-end reads above this insert size will be considered chimeric along with inter-chromosomal pairs.
--METRIC_ACCUMULATION_LEVEL  -LEVEL	[ALL_READS]	The level(s) at which to accumulate metrics.
--REFERENCE_SEQUENCE  -R	null	Reference sequence file. Note that while this argument isn't required, without it only a small subset of the metrics will be calculated. Note also that if a reference sequence is provided, it must be accompanied by a sequence dictionary.
--STOP_AFTER	0	Stop after processing N reads, mainly for debugging.
--version	false	display the version number for this tool
Optional Common Arguments
--COMPRESSION_LEVEL	5	Compression level for all compressed files created (e.g. BAM and VCF).
--CREATE_INDEX	false	Whether to create a BAM index when writing a coordinate-sorted BAM file.
--CREATE_MD5_FILE	false	Whether to create an MD5 digest for any BAM or FASTQ files created.
--GA4GH_CLIENT_SECRETS	client_secrets.json	Google Genomics API client_secrets.json file path.
--MAX_RECORDS_IN_RAM	500000	When writing files that need to be sorted, this will specify the number of records stored in RAM before spilling to disk. Increasing this number reduces the number of file handles needed to sort the file, and increases the amount of RAM needed.
--QUIET	false	Whether to suppress job-summary info on System.err.
--TMP_DIR	[]	One or more directories with space available to be used by this program for temporary storage of working files
--USE_JDK_DEFLATER  -use_jdk_deflater	false	Use the JDK Deflater instead of the Intel Deflater for writing compressed output
--USE_JDK_INFLATER  -use_jdk_inflater	false	Use the JDK Inflater instead of the Intel Inflater for reading compressed input
--VALIDATION_STRINGENCY	STRICT	Validation stringency for all SAM files read by this program. Setting stringency to SILENT can improve performance when processing a BAM file in which variable-length data (read, qualities, tags) do not otherwise need to be decoded.
--VERBOSITY	INFO	Control verbosity of logging.
Advanced Arguments
--showHidden	false	display hidden arguments

Argument details

Arguments in this list are specific to this tool. Keep in mind that other arguments are available that are shared with other tools (e.g. command-line GATK arguments); see Inherited arguments above.

---

--ADAPTER_SEQUENCE / NA

List of adapter sequences to use when processing the alignment metrics.

List[String]  [AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, AGATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG, AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGTCTTCTGCTTG, AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG]

---

--arguments_file / NA

read one or more arguments files and add them to the command line

List[File]  []

---

--ASSUME_SORTED / -AS

If true (default), then the sort order in the header file will be ignored.

boolean  true

---

--COMPRESSION_LEVEL / NA

Compression level for all compressed files created (e.g. BAM and VCF).

int  5  [ [ -∞  ∞ ] ]

---

--CREATE_INDEX / NA

Whether to create a BAM index when writing a coordinate-sorted BAM file.

Boolean  false

---

--CREATE_MD5_FILE / NA

Whether to create an MD5 digest for any BAM or FASTQ files created.

boolean  false

---

--EXPECTED_PAIR_ORIENTATIONS / NA

Paired-end reads that do not have this expected orientation will be considered chimeric.

Set[PairOrientation]  [FR]

---

--GA4GH_CLIENT_SECRETS / NA

Google Genomics API client_secrets.json file path.

String  client_secrets.json

---

--help / -h

display the help message

boolean  false

---

--INPUT / -I

Input SAM or BAM file.

R File  null

---

--IS_BISULFITE_SEQUENCED / -BS

Whether the SAM or BAM file consists of bisulfite sequenced reads.

boolean  false

---

--MAX_INSERT_SIZE / NA

Paired-end reads above this insert size will be considered chimeric along with inter-chromosomal pairs.

int  100000  [ [ -∞  ∞ ] ]

---

--MAX_RECORDS_IN_RAM / NA

When writing files that need to be sorted, this will specify the number of records stored in RAM before spilling to disk. Increasing this number reduces the number of file handles needed to sort the file, and increases the amount of RAM needed.

Integer  500000  [ [ -∞  ∞ ] ]

---

--METRIC_ACCUMULATION_LEVEL / -LEVEL

The level(s) at which to accumulate metrics.

Set[MetricAccumulationLevel]  [ALL_READS]

---

--OUTPUT / -O

File to write the output to.

R File  null

---

--QUIET / NA

Whether to suppress job-summary info on System.err.

Boolean  false

---

--REFERENCE_SEQUENCE / -R

Reference sequence file. Note that while this argument isn't required, without it only a small subset of the metrics will be calculated. Note also that if a reference sequence is provided, it must be accompanied by a sequence dictionary.

File  null

---

--showHidden / -showHidden

display hidden arguments

boolean  false

---

--STOP_AFTER / NA

Stop after processing N reads, mainly for debugging.

long  0  [ [ -∞  ∞ ] ]

---

--TMP_DIR / NA

One or more directories with space available to be used by this program for temporary storage of working files

List[File]  []

---

--USE_JDK_DEFLATER / -use_jdk_deflater

Use the JDK Deflater instead of the Intel Deflater for writing compressed output

Boolean  false

---

--USE_JDK_INFLATER / -use_jdk_inflater

Use the JDK Inflater instead of the Intel Inflater for reading compressed input

Boolean  false

---

--VALIDATION_STRINGENCY / NA

Validation stringency for all SAM files read by this program. Setting stringency to SILENT can improve performance when processing a BAM file in which variable-length data (read, qualities, tags) do not otherwise need to be decoded.

The --VALIDATION_STRINGENCY argument is an enumerated type (ValidationStringency), which can have one of the following values:

STRICT

LENIENT

SILENT

ValidationStringency  STRICT

---

--VERBOSITY / NA

Control verbosity of logging.

The --VERBOSITY argument is an enumerated type (LogLevel), which can have one of the following values:

ERROR

WARNING

INFO

DEBUG

LogLevel  INFO

---

--version / NA

display the version number for this tool

boolean  false

---

Return to top

---

See also General Documentation | Tool Docs Index Tool Documentation Index | Support Forum

GATK version 4.0.11.0 built at 23-11-2018 02:11:49.